0

1  close all open windows at once

Tài liệu Module 1: Introduction to Microsoft Windows 2000 File, Print, and Web Servers pdf

Tài liệu Module 1: Introduction to Microsoft Windows 2000 File, Print, and Web Servers pdf

Hệ điều hành

... installed devices and applications that are known to be incompatible with Windows 2000 You can access the Windows 2000 Readiness Analyzer at http://www.microsoft.com /windows2 000/upgrade/compat/default.asp ... Server Running Windows 2000 Slide Objective To identify the features in Windows 2000 that enhance the print services in Windows NT 4.0 Lead-in Windows 2000 includes several features that make it ... Share Documents and Information across an Intranet or the Internet ASP that Allows You to Create Dynamic, Interactive Web Server Applications Windows Media Services that Allow You to Deliver High-quality...
  • 16
  • 490
  • 0
Tài liệu PHẦN 1. HỆ ĐIỀU HÀNH WINDOWS docx

Tài liệu PHẦN 1. HỆ ĐIỀU HÀNH WINDOWS docx

Tin học văn phòng

... thư mục, tệp 36 1.3.1 Giới thiệu Windows Explorer Sử dụng menu Sử dụng menu Start để mở Start để mở 37 1.3.1 Giới thiệu Windows Explorer  Cách Nhấn hai phím Windows E  Cách Để chuột nút Start ... đối tượng Windows  Thực đơn (Menu) Tập thao tác thị hình mà người sử dụng lựa chọn  Mục Thanh thực đơn Một lựa chọn (thao tác) thực đơn Thực đơn kéo xuống Mục 1.1.3 Các loại đối tượng Windows ... 1.3 Quản lý tệp tin thư mục  1.4 Làm việc desktop Windows Explorer 30 1.3 Quản lý tệp thư mục  1.3.1 Ổ đĩa, thư mục, tệp tin  1.3.2 Giới thiệu Windows Explorer  1.3.3 Sao chép, di chuyển, xóa...
  • 72
  • 1,454
  • 0
Tài liệu Cân bằng tải trong Exchange 2007– Phần 1: Tổng quan về Windows NLB Clusters docx

Tài liệu Cân bằng tải trong Exchange 2007– Phần 1: Tổng quan về Windows NLB Clusters docx

Quản trị mạng

... MAC nhóm ảo, địa MAC sử dụng tất máy chủ Windows NLB cluster Khi chế độ unicast kích hoạt, máy khách kết nối với máy chủ địa MAC nhóm Chế độ Multicast Với Windows NLB cluster cấu hình chế độ multicast ... tương ứng riêng chúng Lưu ý: Bổ sung thêm với Windows NLB, bạn sử dụng chế DNS round robin để cân tải cho máy chủ môi trường thư tín Exchange 2007, nhiên Windows NLB nên sử dụng DNS round robin sau ... lặp lại máy chủ đáp trả thông tin kết nối khách sẵn máy chủ Client Access Vì thành phần Windows NLB có Windows Server 2003 phiên Standard Enterprise nên lý khiến phải chọn DNS round robin WNLB...
  • 5
  • 587
  • 2
tutorial 1 basic android setup windows 2

tutorial 1 basic android setup windows 2

Tin học

... PATH For help on editing the PATH, please follow the tips here: http://www.windowsitpro.com/article/john-savills -windows- faqs/how-cani-add-a-new-folder-to-my-system-path-.aspx After the installation ... downloaded installer file Choose the installation folder for the Android SDK, for example: C:\\Program Files (x86)\\Android\\android-sdk Add the location of the “tools” and “platform-tools” subfolders ... Figure Start-up screen of the Eclipse IDE Downloading and Installing Android SDK Download the Windows installer file installer_r16 -windows. exe for the Google Android SDK from this website: http://developer.android.com/sdk/index.html...
  • 8
  • 392
  • 0
Quản trị mạng Windows Server 2003 - Phần 1 - TỔNG QUAN VỀ WINDOWS SERVER 2003

Quản trị mạng Windows Server 2003 - Phần 1 - TỔNG QUAN VỀ WINDOWS SERVER 2003

Quản trị mạng

... tính nối mạng Windows Server 2003 thừa hưởng tính nối mạng phiên trước đó, có số đặc điểm khác 3.1 NAT Traversal Đây tính trình bày Windows XP Chức NAT Traversal làm để máy bên mạng NAT liên lạc ... (máy nonroutable) bạn thông qua cổng gọi PAT (Port Address Translation) ICS mẩu phần mềm PAT routing tích hợp Windows 2003 ISC bổ sung thêm phần mềm NAT routing mạnh giúp người sử dụng kết nối ... Translation (PAT) ICS mẩu phần mềm PAT tích hợp sẵn Windows Server 2003 9.Thiết lập TCP/IP Win 2003 với địa IP tĩnh 9.1 Định cấu hình TCP/IP với địa IP tĩnh Để thiết lập địa IP cho máy sử dụng Windows...
  • 113
  • 1,425
  • 1
Journal of Mathematical Neuroscience (2011) 1:2 DOI 10.1186/2190-8567-1-2 RESEARCH Open potx

Journal of Mathematical Neuroscience (2011) 1:2 DOI 10.1186/2190-8567-1-2 RESEARCH Open potx

Hóa học - Dầu khí

... that is common to all subpopulations We now have a combination of intrinsic noise terms that are treated in the sense of Ito, and an extrinsic noise term that is treated in the sense of Stratonovich ... network operates in a regime characterized by Gaussian-like fluctuations about attracting solutions (metastable states) of the mean-field equations (at least away from critical Journal of Mathematical ... synchronization [8–15] This concerns the counterintuitive idea that an ensemble of independent oscillators can be synchronized by a randomly fluctuating input applied globally to all of the oscillators...
  • 28
  • 357
  • 0
Journal of Mathematics in Industry (2011) 1:4 DOI 10.1186/2190-5983-1-4 RESEARCH Open pot

Journal of Mathematics in Industry (2011) 1:4 DOI 10.1186/2190-5983-1-4 RESEARCH Open pot

Hóa học - Dầu khí

... unlikely that this equality happens As to surfaces, we state Journal of Mathematics in Industry (2011) 1:4 Page 13 of 19 Problem Show that the natural correspondence between combinatorially equivalent ... Curvatures of polyhedral surfaces A pair of parallel meshes M, M which are thought to be at distance d can be used to define curvatures of the faces of M Note that the set of meshes combinatorially ... be said that very few surfaces possess patterns of geodesics which run parallel at constant distance: They exist precisely on the intrinsically at surfaces with vanishing Gaussian curvature For...
  • 19
  • 301
  • 0
Journal of Mathematics in Industry (2011) 1:5 DOI 10.1186/2190-5983-1-5 RESEARCH Open Access ECMI docx

Journal of Mathematics in Industry (2011) 1:5 DOI 10.1186/2190-5983-1-5 RESEARCH Open Access ECMI docx

Hóa học - Dầu khí

... formal strategy statements The common challenge for industry and the mathematical community is Journal of Mathematics in Industry (2011) 1:5 Page of to inseminate corporate foresight by translating ... focused on applications rather than on mathematical subjects An ECMI conference is held every two years, attended by academic applied mathematicians and industrial scientists, the latter comprising ... expertise at the various centres ECMI Educational Programme The central aim of the programme ‘Mathematics for Industry’ is to offer to master students in mathematics and other closely related fields...
  • 6
  • 274
  • 0
Journal of Mathematics in Industry (2011) 1:8 DOI 10.1186/2190-5983-1-8 RESEARCH Open pot

Journal of Mathematics in Industry (2011) 1:8 DOI 10.1186/2190-5983-1-8 RESEARCH Open pot

Hóa học - Dầu khí

... and finally obtain the wall permeability K ∗ = · 10−15 m2 , ensuring that at the end of the tube the water delivery rate is 80% of the one at the entrance Another piece of information that we ... at its initial value by providing water at the same rate at which it is delivered to the ground along the whole pipe (which can be calculated since in that case the pressure is known) Alternatively, ... problem that, to our knowledge, has never received attention from mathematical community Therefore the related literature can be found in engineering journals and is addressed to the derivation of...
  • 15
  • 257
  • 0
Journal of Mathematical Neuroscience (2011) 1:5 DOI 10.1186/2190-8567-1-5 RESEARCH Open pptx

Journal of Mathematical Neuroscience (2011) 1:5 DOI 10.1186/2190-8567-1-5 RESEARCH Open pptx

Hóa học - Dầu khí

... interpreted as a first approximation They have to be modified slightly such that they really vanish for negative values of t The numerical calculations show that only small modifications are necessary The ... combination ˇ with the structure equations allow for an explicit approximate calculation of hc In the case c = this procedure gives the precise value up to a multiplicative constant Recall that ... that is then satisfied approximately The quantities in the equation at first are derivatives of the output function Wf (a, t) and its Hilbert transform A further calculation then shows that the result...
  • 54
  • 248
  • 0
Moncayo EJNMMI Research 2011, 1:9 http://www.ejnmmires.com/content/1/1/9 REVIEW Open doc

Moncayo EJNMMI Research 2011, 1:9 http://www.ejnmmires.com/content/1/1/9 REVIEW Open doc

Hóa học - Dầu khí

... chelator to a somatostatin analog Eur J Nucl Med Mol Imaging 2010, 37:1551-1558 153 Rocheville M, Lange DC, Kumar U, Patel SC, Patel RC, Patel YC: Receptors for dopamine and somatostatin: formation ... receptor-activity-modifying proteins; Se: selenium; SSA: somatostatin analogs; SST: somatostatin; SSTR: somatostatin receptors; TAO: thyroid- associated orbitopathy; TCM: traditional Chinese medicine; TMD: ... action of somatostatin on lipolysis in chicken adipocytes Biochim Biophys Acta 1983, 763:191-196 Simon MA, Romero B, Calle C: Characterization of somatostatin binding sites in isolated rat adipocytes...
  • 16
  • 314
  • 0
Saika et al. AMB Express 2011, 1:6 http://www.amb-express.com/content/1/1/6 ORIGINAL Open doc

Saika et al. AMB Express 2011, 1:6 http://www.amb-express.com/content/1/1/6 ORIGINAL Open doc

Hóa học - Dầu khí

... min) At the end of the cultivation period, the supernatant was discarded after the mutant cells were pelleted by centrifugation Finally, the cell pellets in the 96-well plate were dried at 55°C ... al 2009) showed that supplementation of g/L leucine had negative effect on 3H4MV fraction In this study, we also observed the negative effect on 3H4MV fraction at low concentration of leucine ... encapsulated in aluminum pans and analyzed with a Perkin-Elmer Pyris DSC (Perkin-Elmer, Waltham, MA, USA) in the temperature range of -50 to 200°C at a heating rate of 20°C/min under nitrogen atmosphere...
  • 8
  • 473
  • 0
Kato and Iefuji AMB Express 2011, 1:7 http://www.amb-express.com/content/1/1/7 ORIGINAL Open ppt

Kato and Iefuji AMB Express 2011, 1:7 http://www.amb-express.com/content/1/1/7 ORIGINAL Open ppt

Hóa học - Dầu khí

... cells were incubated at 30°C for days on YM medium Then × 106 cells/ml was inoculated to the model wastewater in an Erlenmeyer flask Cultures were incubated at 30°C with shaking at 105 rpm and ... indicating that gene expression was induced by maltose Treatment of model wastewater HF-AAMY cells and cells of the parent strain H fabianii J640 grew at about the same rate in the model wastewater ... the wastewater treatment yeast, H fabianii J 640, and we created new wastewater treatment yeast transformants (HF-XYN and HF-AAMY) The expression of the foreign gene that was integrated in the...
  • 6
  • 260
  • 0
Kolvenbach et al. AMB Express 2011, 1:8 http://www.amb-express.com/content/1/1/8 ORIGINAL Open ppt

Kolvenbach et al. AMB Express 2011, 1:8 http://www.amb-express.com/content/1/1/8 ORIGINAL Open ppt

Hóa học - Dầu khí

... centrifugation (21,500 * g for 15 min), five preparations of cell extract were pooled to a volume of 65 mL and subjected to ammonium sulfate precipitation, by adding ammonium sulfate to 40% saturation ... solution of 20 mM substrate to reach a final substrate concentration of 200 μM As the enzyme was subject to suicide deactivation upon incubation with HQ, only initial rates recorded within 20 ... assembly and provided nucleotide sequence data FLPG elaborated GC-MS data, conceived fragmentation patterns and commented on the manuscript HPEK participated in the design of the study and Page...
  • 11
  • 401
  • 0
Rocha et al. AMB Express 2011, 1:9 http://www.amb-express.com/content/1/1/9 ORIGINAL Open docx

Rocha et al. AMB Express 2011, 1:9 http://www.amb-express.com/content/1/1/9 ORIGINAL Open docx

Hóa học - Dầu khí

... revealed that the cell growth was more concentrated around the oil droplets than in the water phase (data not shown), which indicated that P aeruginosa ATCC 55925 was chemotactically attracted ... biodegradation This is especially true when methylation occurs at the saturate b-carbon, which is known to inhibit b-oxidation unless the bacterial population is able to b-descarboxymethylate (Schaeffer ... patterns of alkane oxidation In this study we investigated the patterns and kinetics of alkane degradation by a biosurfactant-producing Pseudomonas aeruginosa (ATCC 55925) grown on natural heating...
  • 10
  • 289
  • 0
Kataoka et al. AMB Express 2011, 1:10 http://www.amb-express.com/content/1/1/10 ORIGINAL Open ppt

Kataoka et al. AMB Express 2011, 1:10 http://www.amb-express.com/content/1/1/10 ORIGINAL Open ppt

Hóa học - Dầu khí

... ATGCAAGCTT(HindIII)TTCGCAGGAAAGCCATG P2L promoter P2L-F GCAGGCATGC(SphI)GATCAGCTTGAAATATGTACATAG P2L-R ATGCAAGCTT(HindIII)TGATAAATTTATTTATTTAGGATCCGATCT PTet promoter PTet-F gcagGCATGC(SphI)GTTCAACAAACGGGCCATAT PTet-R aTgcAAGCTT(HindIII)AATAATGAGGGCAGACGTAG ... ATccTCTAGA(XbaI)TTGATTTAAGTGAACAAGTTTATCCATC pHY300PLK ΔtetL TZ-F ATCGTTAAGGGATCAACTTTGGGAG TZ-R ATTTCACCCTCCAATAATGAGGGC Kmr (kan) K-F ATTGGAGGGTGAAATATGAGAATAGTGAATGGACCAA K-R TGATCCCTTAACGATTCAAAATGGTATGCGTTTTGAC ... aTgcAAGCTT(HindIII)TGGTACCGCTATCACTTTAT PKm promoter PKm-F gcagGCATGC(SphI)GCTATGACCATGATTACGAA PKm-R aTgcAAGCTT(HindIII)TGTATTACTGTTTATGTAAGCAGAC P2N promoter P2N-F GCAGGCATGC(SphI)TCACTTCGTACATAATGGAC P2N-R ATGCAAGCTT(HindIII)TTCGCAGGAAAGCCATG...
  • 11
  • 351
  • 0
Nguyen et al. AMB Express 2011, 1:22 http://www.amb-express.com/content/1/1/22 ORIGINAL Open potx

Nguyen et al. AMB Express 2011, 1:22 http://www.amb-express.com/content/1/1/22 ORIGINAL Open potx

Hóa học - Dầu khí

... TCTACATCCAGAACAACCTCTGC 5’ end of Pspac ON64 ON65 GGCCATAGATCTATGCGCCGGGATCAAAAAATG GGCCATAGATCTATGAAAAAAGTTATTCCACTATTCATCATTGC 5’ end of ywpE 5’ end of yhcS 3’ end of yhcS ON66 GGCCATAGATCTAGAATGAAGAAAAGCCGCAGGCACT ... yhcR ON49 GGCCATGACGTCCGCATGTTTGATATTGAAGAAGC 5’ end of yfkN ON50 AGCAGCGATATCTTATGCCTGATTCGCTCTATTCTG 3’ end of yfkN ON54 GGCCATTTCGAAGACCTCTTTAGCTCCTTGGAAGC 3’ end of erm ON55 GACCTGAATGTGGAACGAGTGGAC ... end of yhcS ON60 CTAATACGACTCACTATAGGGAGAGGATCCCGACACCTTTTTCTAAATCA 3’ end of yhcS ON61 GGCCATGAATTCAAAGGAGGAACAACAATGCGCCGGGATCA 5’ end of ywpE ON62 CTAATACGACTCACTATAGGGAGAGGATCCTCTTCGTGCTTCACTCTTGC...
  • 11
  • 283
  • 0
Kumagai et al. AMB Express 2011, 1:23 http://www.amb-express.com/content/1/1/23 ORIGINAL Open pptx

Kumagai et al. AMB Express 2011, 1:23 http://www.amb-express.com/content/1/1/23 ORIGINAL Open pptx

Hóa học - Dầu khí

... the PLL-coated ITO electrode and incubated for h at 37°C/5% CO2 Multinuclear activation of a galactosidase indicator (MAGI) assay HIV-1LAI or HIV-1KMT that had adsorbed onto the PLLcoated ITO ... from the infection rate of electrically stimulated and unstimulated HIV-1, respectively After application of an electrical potential at 1.0 V (vs Ag/ AgCl) for 2, and min, the rate of HIV-1LAI inhibition ... microscope Data represent the geometric mean ± standard deviation of duplicate determinations Apoptotic cells after electrical stimulation The apoptotic rate of MAGIC-5 cells after application of...
  • 6
  • 433
  • 0

Xem thêm

Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008